Random Thought of the Day

The Blanket Octopus isn't as cuddly as its name might suggest.

Instead of projecting ink into the face of a predator, the blanket octopus will unfurl its massive webbed tentacles and frighten off its pursuer!

Or if that doesn't work, the blanket octopus also likes to carry around the tentacles of the highly venomous Portuguese Man-of-War which it won't hesitate to throw into your face if you get too close!

Random Thought of the Day

Who knew mosquitoes could be so pretty?!

Sabethes mosquito is actually from the planet Pandora...

These guys are found in the forests of Central and South America.

Apparently, the furry parts on their legs and their shimmery complexion are sexually selected traits and the males perform complex dances to win over the ladies.

The San Juans

In a few hours I will be leaving to the San Juan Archipelago to survey the entire island of San Juan.

Yeah, I know you're jealous

That's a lot of birds.

We separate the island into two halves - the American Camp and the British Camp.

I was curious as to why the island is separated this way, so I did a bit of research (i.e. Wiki search!)...

The Oregon Treaty of 1846 established the 49th parallel as the official boundary between the US and British North America, but made no mention of the San Juan Archipelago...

So of course, the British (Canada was officially a British federal dominion until 1982...) and the Americans both claimed ownership over the San Juans...

The conflict escalated in 1859 when an American shot and killed an Irishman's pig while it was eating his potatoes (which is NOT meant to be an insulting innuendo for Irish wives). This escalated to military action and two months later, 461 Americans with 14 cannons were opposed by five British warships mounting 70 guns and carrying 2,140 men...

No shots were fired. The pig was the only fatality...

For 12 years, the two nations maintained a strong military presence on San Juan with the British in a camp to the north and the Americans in a camp to the south.

Apparently it was a very drunken 12 years for the soldiers (together they celebrated every British and American holiday possible...).

The Union Jack is still raised by park rangers every day over the British Camp, making it one of very few places in the US where government employees regularly raise the flag of another country.

Oh yes, and there are birds.

Passerculus sandwichensis
No joke. That's its scientific name.
The Savannah Sparrow

Random Thought of the Day

A fellow blogger just posted this.

I learned some stuff. It was great. Learning is always great. Go learn something fun about urchin anatomy!

For example, I bet you didn't know that urchins poop from the tops of their heads!

Yeah, well, now you know!

Oh, and the gonads really do splooge all over the screen when you click them...

Best Urchin anatomy quiz ever!

Random Thought of the Day

Have you ever heard of Olympus Mons?

It's the largest mountain in the solar system. And it also happens to be the largest volcano in the solar system.

Oh, and it's on Mars, by the way.

Someone's got an acne problem...

It also happens to be so large that as you approach its summit, you wouldn't even notice that you're climbing a mountain at all. The average slope of Olympus Mons is only 5 degrees!

But if you're approaching the mountain from afar, you'll encounter the shield escarpment, a huge 5-mile-high wall!

It's just so freaking big!

That's what she said...

Random Thought of the Day

Kiwis.

No...not those.

You've seen kiwis, right? Of course.

But did you know that...

Kiwi eggs can weigh up to a quarter of their body weight? These birds are about the size of chickens, but their eggs are generally six times larger than chicken eggs! This is the biggest egg-to-body size ratio of any animal in the world!

That would be like giving birth to a 40 pound baby.

Or, for those of you incapable of imagining birth, try this:

Imagine trying to poop out a whole watermelon.

Now imagine a watermelon five times larger...

Or a 40 pound pumpkin/5-year-old?

Yikes.

But wait, there's more!

These birds have quite a few mammal-like traits. For example their feathers are loose and hair-like. And they have whiskers! And their nostrils are on the tips of their beaks (only birds in the world with this trait)! And they have a highly developed sense of smell (extremely rare for birds)! And they forage in through the undergrowth looking for worms and grubs! And they're nocturnal! And they burrow!

And these guys don't actually have wings. Their forelimbs have evolved into tiny little nubs! There's basically nothing left!

And they smell really bad. Some kiwi experts claim to locate new kiwi burrows using smell alone! Or they just train dogs to sniff them out (so they can better protect these endangered organisms, of course).

They're just sooo coool!!!

Happy Birthday!

Today is Charles Darwin's 202nd birthday!

Happy birthday, Charles!

In case you're unfamiliar with this respectable gentleman, here are a few quick facts that might be of interest to you, dear reader.

Of course, as I'm sure you are aware, Darwin is the author of famous works such as On the Origin of the Species, Decent of Man and Selection in Relation to Sex, and Variation of Animals and Plants Under Domestication, and he is largely responsible for the development of the theory of evolution.

As I'm sure you are also aware, Darwin traveled around the world aboard the HMS Beagle collecting, observing and describing hundreds of species previously unknown to science, many of which have since taken his name such as Darwin's Finches.

However, did you know that Darwin originally collected these small brown-black birds without recording a single note about the locations they were collected? In fact, he had tossed them aside, thinking nothing of them. It wasn't until he presented his avian specimens to the ornithologist John Gould, that anyone realized the birds were different species.

Gould was probably like, "Ummm, hey D-win. Did you notice that these little finches are all different species? No? Wait, you didn't gather any data on them?! Epic fail Chuck. Epic fail..."

So Darwin scrambled and found a shipmate who had written down the locations and it was all good.

Perhaps they should be called Gould's finches?

Anywho. Charles still managed to develop his hypothesis on the variation and isolation of these and other species from his voyage and the Origin still became a worldwide best-seller!

Happy Birthday Chuck!

Random Thought of the Day

Ever heard of a Hoatzin?

These birds are perhaps the strangest birds on the face of the planet. No joke.

The first record of these birds comes to us from the Spanish explorer Francisco Hernández who describes their morphology and also writes:

The bones of this bird relieve the pain of wounds in any part of the human body; the odor of the plumage restores hope to those who, from any disease, are steadily wasting away. The ashes of the feathers when devoured relieve the Gallic sickness, acting in a wonderful manner...

Yeah. That's right. They smell like hope. Pure, smelly hope.

But that's not even the best part.

The Hoatzin is actually a foliovore (eats leaves) and has a semi-ruminant stomach (like a cow!).

But wait! There's MORE!

Baby Hoatzins have fingers! That's right. They have two claws on their wings that they use to swim and climb to avoid predators in the trees.

This unique ability prompted many scientists to suggest that the Hoatzin is a "link" between birds and reptiles.

Even today, the Hoatzin's place in the evolutionary bird tree is widely disputed and DNA analysis has only made the situation worse!

Such a cool critter!

Random Thought of the Day

Frazil Ice.

Never heard of it? Educate yo self!

It's actually a really beautiful and astounding phenomenon.

Check it out!



Oh how I love park rangers! Always full of so much knowledge!

Random Thought of the Day

Did you know...

The Arctic Tern migrates farther than any other migratory animal in the world. Actually, they migrate from pole to pole!

Migration route of the Arctic Tern. Breeds in the Arctic (red) and
vacations in the Antarctic (blue).

 That's right, from Arctic to Antarctic and back!

Every year.

That's more than 44,300 miles!!! Holy cow. That's a long way to fly.

Also one of my favorite birds!

A Murder of Crows

Did you know that a group of crows is called a murder?

Did you know that crows are ranked among chimps and elephants as the smartest animals in the world?

Yeah, neither did I!

Here's a great PBS special on the intelligence of crows. I learned all kinds of fun facts about these creepy corvids! But I was most excited to learn that the US Department of Defense is funding the U of WA research with crows' facial recognition abilities!!! Isn't that crazy?! It gives me hope that one day, my avian behavior research might be important enough to receive funding from the government...

Ha ha ha! Yeah right!

Anyway, enjoy the show!

Watch the full episode. See more Nature.

Random Thought of the Day

Ever wondered what your name is in genetic code?

Yeah! Me too!!!

Mine is

AGANNNGACGAGAGAACCCTGGCCTGGAGA

GAGAACTGCGAGAACATCGAGAGCGAG 

which just so happens to be similar to the protein called P33689|NPY_XENLA found in the genome of the African Clawed Frog (you know, those cute little aquatic pet frogs you can buy at your local drug store)!

SO COOL!!!

Decode YOUR name here!

Random Thought of the Day

What if you discovered an ancient tome that was so old, it was impossible to open and read its contents... How on Earth would you ever manage to discover the wealth of information hidden between its covers? Imagine all the discoveries and insight Man would miss out on...

Solution!!!

Just CT scan that shit!

Researchers at the University of Texas in Austin were granted permission to scan a book printed in 1584 by Pedro Orcharte of Mexico. They left the tome inside its protective case and scanned 782 pages using X-ray CT technology, allowing researchers to digitally open the book and read its contents without ever turning a page!

In case you didn't know, CT stands for computed tomography, which, in case you didn't know, is the process of scanning various 2D "slices" of a 3D object in order to visualize the whole object digitally. In the case of this ancient tome, each "slice" that the researchers scanned was a different set of pages. The x-rays used in the CT scan are reflected by the iron in the ink on each page allowing researchers to piece together the entire book one page at a time.

Now if only they could read Latin...

Check out some more info on this really cool scanning method HERE!

Random Thought of the Day

Guam.

I recently educated myself about the interesting plight of Guam. This little island in Micronesia (it's actually petty large) is an organized, unincorporated territory of the United States. That means it has it's own area code. I mean, really? Think about this for a second; Guam is on the other side of the international date-line. But you can call it toll-free from most landlines... (the area code is 671, btw). If I called Guam right now, it is about 7:00am on SATURDAY MORNING! That's tomorrow!!! Frankly, I'm a mildly appalled but mostly amused at all of the US's unincorporated territories. It seems very silly.

But I digress.

The real reason I wanted to tell you about Guam has to do with a good friend of mine who just spent her whole summer there. I had never really heard anything about Guam before I was first educated by mi amiga, Eleanor. Guam used to be home to a great diversity of birds. But then, in WWII, the US military introduced the brown treesnake to the island. Now Guam has no birds, but has the highest density of snakes in the world.

Here's a picture of Eleanor holding one of the world's LAST Guam Rails.

The majority of Guam's endemic species are now critically endangered or extinct. So sad.

In attempts to improve the plight of Guam's endemics, officials on the island have concocted a PLAN!

Get some dead mice. Stuff them with Tylenol, tie them to cardboard, add some streamers, and drop them from helicopters!

Oh good. Thank goodness someone came up with that idea. The island is saved!

But really, this might actually be a good idea even though it sounds completely absurd. As it turns out, the brown treesnake can not ingest acetaminophen. It's toxic to them. So, the hope is that these hungry little snakes will eat the dead, pill-stuffed mice and then die. Hopefully.

They're trying out this interesting method of snake-control on some small areas of forest first. If these experiments work, they might start dropping dead mice all over the island. The people of Guam really hate these snakes.

You can read the whole article here!

Random Thought of the Day

I was recently assigned a short essay to write for my Mars Exploration class. The prompt was,

"How many people are in space right now?"

So I Googled it: "how many people are in space right now?"

and got this website:

www.HowManyPeopleAreInSpaceRightNow.com

Yup. That's it.
That was an easy essay.

As a side note, Don't you find it sad that we have been sending people into space for more than 50 years, and yet there are only SIX people in space right now... There has been essentially NO progress in space flight/travel/exploration since the mid-seventies. Does anyone even care about this anymore?

I find it very, very sad.

Random Thought of the Day

So, I am sitting here prepping for two different labs focusing on the identification of marine invertebrates and I just had to share some fun information!

Did you know that in some parts of the deep ocean, more than 80% of organisms are bioluminescent?!

That's a crazy high percentage, isn't it?! There's this chica, Edith Widder

who has dedicated her life to studying marine invertebrates of the deep oceans. She invented this brilliant, yet simple method to observe animals of the deep without scaring them off with bright lights and loud engines. With this new method she has discovered tons of new species! Check it out!



This is a video from TED Talks, of course. Once again, gotta love TED.

I just pulled an all-nighter...

Poor life-choice number one for this week: pulling an all-nighter.

I stayed up last night finishing my research poster. Don't worry, it turned out great, it's probably the best research poster you have ever seen. But I didn't go to bed until about 7:30.

Now that I have been up for a full 24 hours without sleep, I just have to wonder...

What would my brain look like on an MRI scan right now?!  I wonder if it's any different than a fully rested brain?!

So I found out!

Dear Internet,
I love you.
Love,
Robert

There was a study conducted in 2007 by Matthew Walker,et al. (The emotional human brain without sleep- a prefontal amygdala disconnect. Current Biology, 17:877-878) that put a whole bunch of well-rested (12) and 35-hour-sleep-deprived individuals (14) into a MRI scanner (not all at the same time, of course!) and showed them images to illicit an emotional response. Then when their brain was responding and showing emotion, the scientists took a picture:

The brain on the left is a normal brain, showing a normal emotional reaction in the amygdala region.

The brain on the right, is a sleep-deprived brain. It is showing an erratic, uncontrolled and over-activated emotional response. This crazy response, as it turns out, closely resembles a much more primitive pattern of activity. The sleep-deprived brain is unable to put emotional experiences into context and cannot produce controlled appropriate responses.

Therefore, sleep-deprived individuals really do turn into....

Zombies! Incapable of appropriate emotional responses to emotional experiences.

Ok, but really, this research suggests that sleep and psychological disorders may be linked. Previous studies have shown that many patients with psychiatric disorders often also suffer from sleep disorders.

So here's the big take-home message: Get plenty of sleep each night, and you really will wake up in a better mood and have a better, less emotionally stressful day! Thanks for the advice, mom! Even though you didn't know it, IT'S SCIENCE!

Now, if we could just work on your fly-catching hypotheses...

Twitterology? Yes. Twitterology.

If it exists, there are people studying it. Twitter is now the subject of some potently puzzling psychological ponderables. Although I am not a twitter user and have absolutely no desire to become one, this research is very interesting.
Check it out:

"5. Men are Twitter leaders: Some suggestions of sex differences come from Heil & Piskorski (2009). They found that there were slightly more women than men on Twitter (55% women), but that, on average, men had 15% more followers than women, with men twice as likely to follow another man as they were a woman, and women 25% more likely to follow men. Both men and women, however, were found to tweet at the same rate. This finding is unusual given that it's normally women who are the focus of attention on social networks, from both other men and other women."

 Interesting, no?

Here's another good one: "10% of twitter users contribute 90% of the tweets." That means that the vast majority of twitter users are actually just following, not tweeting. Muy interesante, verdad?

Ok, one more: "Alan Mislove and colleagues collected 300 million tweets from the US, analysed their emotional content, and produced a 'mood of the nation' video. It shows how the emotional content of people's tweets changes over the day (red is negative and green positive)." Using this form of analysis, Mislove has also determined that Monday is not the most depressing day of the week! Crazy, right?

Here's the video:


Anyway, you can read the whole story here at this super interesting psychology blog!

Whoa! Why didn't I know this?!?!

As a short follow-up to my last random daily thought...

the Nicoya Peninsula in north-western Costa Rica was named a Blue Zone in 2007!!!

A Blue Zone, by the way, is an area with a high rate of active centenarians. Remember centenarians from my last post? Well, check out their web page and really cute videos of old people.

Anyway, I have visited this area of Costa Rica! Kinda. Actually, I've been to the areas around the peninsula. I didn't really get to spend much time on the peninsula. But it still counts.

The Guanacaste region of Costa Rica was definitely my favorite place we visited. I especially miss those huge Guanacaste trees, Enterolobium cyclocarpum. (The picture below isn't actually an E. cyclocarpum, but that one off in the distance might be. The umbrella shaped one. I just like this picture.)

So, not only is Costa Rica the happiest country in the world, it also has the highest life expectancy among 60-year-olds in the entire WORLD (meaning, if you make it to 60, it is very likely that you'll also make it to 100). I guess I'll just have to move back there soon!

Live Longer. Live Better.

Random Thought of the Day

How to live to be 100+

Apparently, there is a great deal of research surrounding centenarians.
P.S. A centenarian is an individual who has lived for 100 years or more. Now you know!

Most of this centenarian research is in regards to diet, exercise and general lifestyle habits.

However...

That's not all that scientists are researching. Apparently love has a lot to do with it. Human contact and interaction play an important role in whether you'll reach 60 or 100.

Check it out. Here's a TED Talk on this very same subject!



In addition to this TED Talk, I also started thinking about longevity when a friend told me he was on a paleo diet. What is a paleo diet, you ask? Well, basically, it means eating, exercising and living like...a caveman.

Yup. The caveman diet. It actually sounds very appealing and I'm halfway there anyway. Learn more about it HERE. I would recommend muting the sound, FYI. Silly music.