Yeah! Me too!!!
Mine is
AGANNNGACGAGAGAACCCTGGCCTGGAGA
GAGAACTGCGAGAACATCGAGAGCGAG
which just so happens to be similar to the protein called P33689|NPY_XENLA found in the genome of the African Clawed Frog (you know, those cute little aquatic pet frogs you can buy at your local drug store)!SO COOL!!!
Decode YOUR name here!
No comments:
Post a Comment