I enjoy silly science comics. This one is exceptionally silly. ¡DisfrĂștalo!
Potent Puzzling Ponderables Robert Ponders When He's Not Pondering Pertinently Pressing Prescribed Problems or Prose.
Friday, December 31, 2010
Thursday, December 30, 2010
Otis, the Great Bustard
Otis tarda, the Great Bustard. An endangered, migratory species that once was found across the open grasslands of Europe and Asia.
Otis is the world's largest flying bird.
He also has a rather queer breeding display...
Otis is the world's largest flying bird.
He also has a rather queer breeding display...
Otis is a loner. He looks really silly in that hat.
Judgmental Barn Owls would have a thing or two to say about this new 'fit.
Judgmental Barn Owls would have a thing or two to say about this new 'fit.
Wednesday, December 29, 2010
Random Thought of the Day
Barn Swallows are pretty neat. The females select males based on the length of their streamer tails. Males with long streamers are more fit (they can dedicate more energy to growing long tail feathers), they have lower parasite loads, longer lived, disease resistant, and have a higher vitality.
They are also quite promiscuous. Barn swallows are socially monogamous, but genetically polygamous.
In other words...
they're cheaters.
They are also quite promiscuous. Barn swallows are socially monogamous, but genetically polygamous.
In other words...
they're cheaters.
She caught the early train home. She gets bitchy when she molts. Avian PMS.
Tuesday, December 28, 2010
Random Thought of the Day
Did you know...
The Arctic Tern migrates farther than any other migratory animal in the world. Actually, they migrate from pole to pole!
That's right, from Arctic to Antarctic and back!
Every year.
That's more than 44,300 miles!!! Holy cow. That's a long way to fly.
Also one of my favorite birds!
The Arctic Tern migrates farther than any other migratory animal in the world. Actually, they migrate from pole to pole!
| Migration route of the Arctic Tern. Breeds in the Arctic (red) and vacations in the Antarctic (blue). |
That's right, from Arctic to Antarctic and back!
Every year.
That's more than 44,300 miles!!! Holy cow. That's a long way to fly.
Also one of my favorite birds!
Saturday, December 25, 2010
Mr. Edwards, the Ferruginous Hawk
And I'm Back!
Hey! Finally have spare time again! Yay more blogging!
I have been wanted to blog something like this for a while now (partially inspired by Aaron's Emotional Marine Animals over at Tumblr). Hope you enjoy:
I have been wanted to blog something like this for a while now (partially inspired by Aaron's Emotional Marine Animals over at Tumblr). Hope you enjoy:
Judgmental Barn Owls. Little Known Fact: Owls can get boob-jobs.
Friday, November 5, 2010
A Murder of Crows
Did you know that a group of crows is called a murder?
Did you know that crows are ranked among chimps and elephants as the smartest animals in the world?
Yeah, neither did I!
Here's a great PBS special on the intelligence of crows. I learned all kinds of fun facts about these creepy corvids! But I was most excited to learn that the US Department of Defense is funding the U of WA research with crows' facial recognition abilities!!! Isn't that crazy?! It gives me hope that one day, my avian behavior research might be important enough to receive funding from the government...
Ha ha ha! Yeah right!
Anyway, enjoy the show!
Did you know that crows are ranked among chimps and elephants as the smartest animals in the world?
Yeah, neither did I!
Here's a great PBS special on the intelligence of crows. I learned all kinds of fun facts about these creepy corvids! But I was most excited to learn that the US Department of Defense is funding the U of WA research with crows' facial recognition abilities!!! Isn't that crazy?! It gives me hope that one day, my avian behavior research might be important enough to receive funding from the government...
Ha ha ha! Yeah right!
Anyway, enjoy the show!
Watch the full episode. See more Nature.
No Time for Blogging!
But I still have time for SCIENCE!
In this week's news, National Geographic has announced that it officially stole my Watson Fellowship proposal and turned it into a television special.
It was my idea first!!!! Curse you Nat Geo!!!!
No, I take it back. I love Nat Geo. But they better make it up to me some day. Perhaps with my own TV show? Yes please.
Ok, back to the point. Great Migrations! I cannot even begin to describe how excited I am for this television series!!! I mean, I had proposed to spend an entire year of my life dedicated to studying massive migratory phenomena!!!
And massive animal migrations raise so much awareness for conservation issues! Animals that migrate don't adhere to our strict political boundaries. If we want to effectively prevent their extinction, we must work together and fight to conserve critical points along their 10,000 mile migration routes! Oh, it's so beautiful!
Alright, now that I've gushed about that, you should check out some of the beautiful photos from the series!
Oooooh!!!! So beautiful!
Also, I must apologize for my excessive use of exclamation marks in this post. I just get really excited about this topic...
In this week's news, National Geographic has announced that it officially stole my Watson Fellowship proposal and turned it into a television special.
It was my idea first!!!! Curse you Nat Geo!!!!
No, I take it back. I love Nat Geo. But they better make it up to me some day. Perhaps with my own TV show? Yes please.
Ok, back to the point. Great Migrations! I cannot even begin to describe how excited I am for this television series!!! I mean, I had proposed to spend an entire year of my life dedicated to studying massive migratory phenomena!!!
And massive animal migrations raise so much awareness for conservation issues! Animals that migrate don't adhere to our strict political boundaries. If we want to effectively prevent their extinction, we must work together and fight to conserve critical points along their 10,000 mile migration routes! Oh, it's so beautiful!
Alright, now that I've gushed about that, you should check out some of the beautiful photos from the series!
Oooooh!!!! So beautiful!
Also, I must apologize for my excessive use of exclamation marks in this post. I just get really excited about this topic...
Thursday, October 28, 2010
New species of MONKEY!
New monkey discoveries are always exciting. Everyone loves finding more cute primates!
Too bad this one is butt-ugly.
The Myanmar Snub-nosed Monkey, first discovered by local hunters was finally described by science this week. A team of experts traveled to Myanmar after hearing rumors of a new species of monkey there. This is the first photographic evidence of the species.
The local hunters have killed this individual and will be eating him for dinner soon. The demand for bush meat in areas like this has driven many of rare species populations into decline.Specifically, this tiny population of monkeys (approximately 300 individuals) is also being threatened by logging and habitat fragmentation which has prompted the IUCN to label the species as Critically Endangered.
On a lighter note, because of the organism's oddly shaped nose and upturned nostrils, the Myanmar Snub-nosed Monkey apparently sneezes in the rain. Hahaha, silly monkey!
If you're interested in more information regarding this discovery, check out this link!
Too bad this one is butt-ugly.
The Myanmar Snub-nosed Monkey, first discovered by local hunters was finally described by science this week. A team of experts traveled to Myanmar after hearing rumors of a new species of monkey there. This is the first photographic evidence of the species.
The local hunters have killed this individual and will be eating him for dinner soon. The demand for bush meat in areas like this has driven many of rare species populations into decline.Specifically, this tiny population of monkeys (approximately 300 individuals) is also being threatened by logging and habitat fragmentation which has prompted the IUCN to label the species as Critically Endangered.
On a lighter note, because of the organism's oddly shaped nose and upturned nostrils, the Myanmar Snub-nosed Monkey apparently sneezes in the rain. Hahaha, silly monkey!
If you're interested in more information regarding this discovery, check out this link!
Thursday, October 21, 2010
Random Thought of the Day
Ever wondered what your name is in genetic code?
Yeah! Me too!!!
Mine is
SO COOL!!!
Decode YOUR name here!
Yeah! Me too!!!
Mine is
AGANNNGACGAGAGAACCCTGGCCTGGAGA
GAGAACTGCGAGAACATCGAGAGCGAG
which just so happens to be similar to the protein called P33689|NPY_XENLA found in the genome of the African Clawed Frog (you know, those cute little aquatic pet frogs you can buy at your local drug store)!SO COOL!!!
Decode YOUR name here!
Tuesday, October 12, 2010
I have a new favorite blog!
I have been on a really big Marine Biology kick recently. As a matter of fact, I will be tested on phytoplankton, zooplankton, nekton and intertidal ecology today! Oh goodie!
Anyway, I am in love with this marine bio buff from Hawaii. Specifically, he posts some great photos of marine life with even greater captions. For example
My favorite parts are the "tags" at the bottom: OCD Shark, Reef Quiche Is Quite Tasty, EMA (for Emotional Marine Animals).
Here's another one of my favorites:
Tags: Gettin' All Nerdy Up In This Bitch, EMA
Oh my goodness. So nerdy. I love it!!!
Check out the rest of his blog, a.k.a. the Incurablog!
Anyway, I am in love with this marine bio buff from Hawaii. Specifically, he posts some great photos of marine life with even greater captions. For example
Jay thought for a second. Did he leave the oven on? He couldn’t remember if he’d turned it off after making that quiche. Dammit, now he was going to have to go back and check! This always happened before a meeting!
My favorite parts are the "tags" at the bottom: OCD Shark, Reef Quiche Is Quite Tasty, EMA (for Emotional Marine Animals).
Here's another one of my favorites:
So then he says,
“Non-Obligate Ram Ventilator? I hardly know ‘er!”
And then he makes this face.
Tags: Gettin' All Nerdy Up In This Bitch, EMA
Oh my goodness. So nerdy. I love it!!!
Check out the rest of his blog, a.k.a. the Incurablog!
Thursday, October 7, 2010
The Creatures of Avatar!
Have you seen that little movie that came out recently called Avatar?
You have? Oh good!
Did you know that there are active evolutionary biologists, xenobiologists and exobiologists dedicated to researching the flora and fauna of Pandora and the other moons of Polyphemus?
Yes, you are correct, Pandora and Polyphemus are not real places. And yes, it is true that most of these plants and animals do not exist... most of them...
Believe it or not, not all of these crazy creatures and fantastic plants are fake. I don't want to give away all the good stuff since Elements Science Magazine will be publishing a major feature article on the science behind these (mostly) fictional creatures, so here's my favorite:
The Great Leonopteryx. Or in the language of the Na'vi, Toruk
Actually, toruk is based on an ancient creature that once ruled the skies of our very planet. This flying dinosaur, called Tapejara, was a piscivorous giant with a 16-foot wingspan and a crest between 4 and 6 feet long!
Can you see the resemblance?
For more info on the flora and fauna of Pandora, check out this great Interactive Field Guide!
You have? Oh good!
Did you know that there are active evolutionary biologists, xenobiologists and exobiologists dedicated to researching the flora and fauna of Pandora and the other moons of Polyphemus?
Yes, you are correct, Pandora and Polyphemus are not real places. And yes, it is true that most of these plants and animals do not exist... most of them...
Believe it or not, not all of these crazy creatures and fantastic plants are fake. I don't want to give away all the good stuff since Elements Science Magazine will be publishing a major feature article on the science behind these (mostly) fictional creatures, so here's my favorite:
The Great Leonopteryx. Or in the language of the Na'vi, Toruk
Actually, toruk is based on an ancient creature that once ruled the skies of our very planet. This flying dinosaur, called Tapejara, was a piscivorous giant with a 16-foot wingspan and a crest between 4 and 6 feet long!
Can you see the resemblance?
For more info on the flora and fauna of Pandora, check out this great Interactive Field Guide!
Random Thought of the Day
Craig Venter recently announced that his team of scientists have created the very first synthetic lifeforms. Using a computer code and a few jars of chemicals, Venter and his researchers have created a brand new species of bacteria.
He says that with this breakthrough, we have gained an intimate understanding of the complexities of life which will soon allow us to invent life as we desire.
"We have a program with Exxon Mobile to try and develop new strains of algae [seaweed] that can efficiently capture carbon dioxide from the atmosphere or from concentrated sources [such as the recent oil spill in the Gulf], to make new hydrocarbons that can go into their refineries to make normal gasoline and diesel fuel out of CO2." -Craig Venter, May 2010
See the whole presentation here: Craig Venter unveils "synthetic life"
He says that with this breakthrough, we have gained an intimate understanding of the complexities of life which will soon allow us to invent life as we desire.
"We have a program with Exxon Mobile to try and develop new strains of algae [seaweed] that can efficiently capture carbon dioxide from the atmosphere or from concentrated sources [such as the recent oil spill in the Gulf], to make new hydrocarbons that can go into their refineries to make normal gasoline and diesel fuel out of CO2." -Craig Venter, May 2010
See the whole presentation here: Craig Venter unveils "synthetic life"
Wednesday, October 6, 2010
Have you ever GoogleMaps-ed Antarctica?
Not only has GoogleMaps documented Antarctica for your directional convenience, but they have also included...
STREET VIEW!!!
Note that the "street view figure" has been changed to a cute little penguin!!!
Now go forth and explore the antarctic!
STREET VIEW!!!
Note that the "street view figure" has been changed to a cute little penguin!!!
Now go forth and explore the antarctic!
Tuesday, October 5, 2010
I am having problems escaping these little guys...
Nudibranchs. Again.
But, c'mon! THEY ARE SO FREAKING COOL!!!!
For example: this is not a creature from a Kingdom Hearts/Final Fantasy video game. This is real nudibranch!!!
Oh. my. goodness.
Here's another:
And another for good measure:
But, c'mon! THEY ARE SO FREAKING COOL!!!!
For example: this is not a creature from a Kingdom Hearts/Final Fantasy video game. This is real nudibranch!!!
Oh. my. goodness.
Here's another:
And another for good measure:
It's so tiny!!! Like a tiny glob of toothpaste!!!
Ok, I couldn't resist. Here's one more:
Bahaha! I freaking LOVE NUDIBRANCHS!!!!!
In case you couldn't tell...
Also, I found all of these great photos via fuckyeahbranchs.tumblr.com
Check. it. out.
Random Thought of the Day
So there's this friend of mine who is really in to mucus.
No, not music, mucus.
You may think mucus is a weird thing to be bonkers about, but you just haven't seen the wonders of MAGIC MUCUS!
For example, the lungfish (a type of fish with a lung) can do this nifty little trick when all the water in its pond dries up; they burrow down into the mud and secrete a sac of (you guessed it!) mucus! This mucus sac solidifies, trapping moisture around their bodies. They can stay in this state of suspended animation for up to four years!!! That's some pretty cool mucus!
Ok, Here's another. Parrot fish secret a mucus bubble when they go to sleep each night. These are pretty big fish. Some can be up to a meter long (that's more than 3 feet, for all you non-metric users). So that's a lot of mucus! This isn't your average mucus bubble either. It holds the fish in place while it sleeps, it hides its scent from predators, serves as an intruder alarm system, has antioxidant properties that may heal damaged tissues, and protects against UV rays. I'd like to see YOUR mucus do that!
Ok, one more. You may already know this, but nudibranchs also have really cool mucus. Specifically, the Shaggy Mouse nudi (Aeolidia papillosa) uses its mucus to defend against the stinging tentacles of its favorite food: anemones!!! It secretes a layer of mucus over the tentacles of the anemone which relaxes the anemone's nematocyts (stinging cells) preventing them from firing their stinging barbs. The coolest part about these nudis is that they secrete a specific mucus for each type of anemone they eat!!! That's some really smart mucus!
No, not music, mucus.
You may think mucus is a weird thing to be bonkers about, but you just haven't seen the wonders of MAGIC MUCUS!
For example, the lungfish (a type of fish with a lung) can do this nifty little trick when all the water in its pond dries up; they burrow down into the mud and secrete a sac of (you guessed it!) mucus! This mucus sac solidifies, trapping moisture around their bodies. They can stay in this state of suspended animation for up to four years!!! That's some pretty cool mucus!
Ok, Here's another. Parrot fish secret a mucus bubble when they go to sleep each night. These are pretty big fish. Some can be up to a meter long (that's more than 3 feet, for all you non-metric users). So that's a lot of mucus! This isn't your average mucus bubble either. It holds the fish in place while it sleeps, it hides its scent from predators, serves as an intruder alarm system, has antioxidant properties that may heal damaged tissues, and protects against UV rays. I'd like to see YOUR mucus do that!
Ok, one more. You may already know this, but nudibranchs also have really cool mucus. Specifically, the Shaggy Mouse nudi (Aeolidia papillosa) uses its mucus to defend against the stinging tentacles of its favorite food: anemones!!! It secretes a layer of mucus over the tentacles of the anemone which relaxes the anemone's nematocyts (stinging cells) preventing them from firing their stinging barbs. The coolest part about these nudis is that they secrete a specific mucus for each type of anemone they eat!!! That's some really smart mucus!
Thursday, September 30, 2010
Random Thought of the Day
Ancient penguins!!!
Some paleontologists in Peru recently discovered a 36 million year-old penguin fossil! This guy is a HUGE! About twice the size of an emperor penguin! Woah!
Also, unlike modern-day penguins, these guys don't wear the typical penguin tuxedo. Instead, they have brown bellies and gray tops. I like the new wardrobe selection.
Check out the full article here at the NY Times! AND there's this cool video from NatGeo:
Some paleontologists in Peru recently discovered a 36 million year-old penguin fossil! This guy is a HUGE! About twice the size of an emperor penguin! Woah!
P.S. This artist's rendition is not the species that was just recently discovered, however, it's about the same size, so I thought I'd show it to you anyway.
Also, unlike modern-day penguins, these guys don't wear the typical penguin tuxedo. Instead, they have brown bellies and gray tops. I like the new wardrobe selection.
Check out the full article here at the NY Times! AND there's this cool video from NatGeo:
Uh oh... MORE NUDIS!!!
Ok, so these are LOCAL nudibranchs.
Check it; you can find them in the Sound!!!
First is the Giant nudi, Dendronotus iris, is the biggest nudi in the world reaching lengths of more than 30cm!!! Wait, they get cooler. When threatened, they can jump off the ground and swim away! These guys feed only on tube anemones!
Also, they come in many different colors. For example:
Next is a "mystery" animal found in someone's sewer... Surprise! It's a nudibranch! Bet you didn't guess that one!
This is Onchidoris bilamellata or the rough-mantled doris. They're kinda ugly, but they do this really nifty thing during breeding season. Literally thousands of these nudis will congregate and start swarming, slowly crawling in one direction. They all start to follow the slime trails (mucus) of the individual in front of them, forming lines of nudis several hundred long! So COOL!
Check it; you can find them in the Sound!!!
First is the Giant nudi, Dendronotus iris, is the biggest nudi in the world reaching lengths of more than 30cm!!! Wait, they get cooler. When threatened, they can jump off the ground and swim away! These guys feed only on tube anemones!
Also, they come in many different colors. For example:
Next is a "mystery" animal found in someone's sewer... Surprise! It's a nudibranch! Bet you didn't guess that one!
This is Onchidoris bilamellata or the rough-mantled doris. They're kinda ugly, but they do this really nifty thing during breeding season. Literally thousands of these nudis will congregate and start swarming, slowly crawling in one direction. They all start to follow the slime trails (mucus) of the individual in front of them, forming lines of nudis several hundred long! So COOL!
MORE Nudis!!!
I have come to the conclusion that everyone likes nudibranchs. Besides the fact that they are so cute and pretty, they are also REALLY FREAKING COOL!!!
Almost ALL nudis (pronounced like nudies) are specialized to eat ONE type of animal! For example, there are some that eat only anemones. When they eat these anemones, they will absorb the stinging cells from the anemone and add them to their own "tentacles" (actually, those furry, tentacle-like things are called cerata). And these same nudis will also start secreting mucus that can protect them from the anemone's stingers!
But here's a nudi that specializes in eating OTHER NUDIS!!!
It's really beautiful and yet, very sad at the same time.
Hope you enjoy!
Almost ALL nudis (pronounced like nudies) are specialized to eat ONE type of animal! For example, there are some that eat only anemones. When they eat these anemones, they will absorb the stinging cells from the anemone and add them to their own "tentacles" (actually, those furry, tentacle-like things are called cerata). And these same nudis will also start secreting mucus that can protect them from the anemone's stingers!
But here's a nudi that specializes in eating OTHER NUDIS!!!
It's really beautiful and yet, very sad at the same time.
Hope you enjoy!
Wednesday, September 29, 2010
Whoa, I have just seen into my future...
This video was AWESOME!
Well, you might not enjoy learning about the history of ornithology as much as I do, but this short talk is still quite comical.
Actually, in the next 30 years, I will probably end up becoming this man...making jokes about phallic fungi, over-sized testes, and promiscuous female birds...
Yes, definitely me in 30 years.
Also, Mr. Birkhead talks about an example of how this "frivolous field" of ornithology actually has "real-world" significance! Just for you, Mom!
Linked from TED.com
Well, you might not enjoy learning about the history of ornithology as much as I do, but this short talk is still quite comical.
Actually, in the next 30 years, I will probably end up becoming this man...making jokes about phallic fungi, over-sized testes, and promiscuous female birds...
Yes, definitely me in 30 years.
Also, Mr. Birkhead talks about an example of how this "frivolous field" of ornithology actually has "real-world" significance! Just for you, Mom!
Linked from TED.com
Tuesday, September 28, 2010
Blending Science and Art!
Once again, here's a great blend of science and art. I am definitely in love with this form of art!!!
This dude, Nick Veasey is an x-ray photographer. Yeah, that's right, he's doing art with x-rays! His work gives us insight into the world within, allowing us to truly see that "beauty is more than skin deep."
Check it out!
Check out the rest of his amazing work here at his website: http://www.nickveasey.com/
This dude, Nick Veasey is an x-ray photographer. Yeah, that's right, he's doing art with x-rays! His work gives us insight into the world within, allowing us to truly see that "beauty is more than skin deep."
Check it out!
Check out the rest of his amazing work here at his website: http://www.nickveasey.com/
Sunday, September 26, 2010
WHAAAAAAT?????
Holy CRAP!!! I cannot believe that this is possible!!!! This man is amazing. I can't believe it. Completely blowing my mind right now.
Mathemagic. Yup. Math-magic. It sounds pretty cheesy, but OH MY GOODNESS, I am in awe.
Mathemagic. Yup. Math-magic. It sounds pretty cheesy, but OH MY GOODNESS, I am in awe.
Saturday, September 25, 2010
Random Thought of the Day
Here's an absolutely mind-blowing TED lecture presented by an exploration expert. Bill Stone, deep cave explorer, was commissioned by NASA to design a mission to Europa in search of extra-terrestrial life. He used his extensive experience exploring the unknown depths of our own planet to design a robot capable of autonomously exploring, documenting, and analyzing the unknown depths of the Europan oceans. But then he goes on to propose a truly radical idea. Bill Stone wants to build a fueling station in space! And not only that, but he claims that he can do it in the next 7 years using less than one trillion dollars!!!
This man is crazy, but might actually revolutionize space travel in the next 20 years.
This man is crazy, but might actually revolutionize space travel in the next 20 years.
Friday, September 24, 2010
The oldest living things in the world
Can you guess the age of the world's oldest living organism?
2,000 years old? Nope.
4,000 years old? Not even close.
10,000 years old? Still not close.
100,000 years old? Warmer, but no.
The oldest living thing on Earth is more than 500,000 years old. That's half a MILLION years old!!!
Artist, philosopher and biologist Rachel Sussman has spent the last five years traveling the globe in search of the world's oldest living things. She sees this project as an opportunity for humans to reconsider our idea of time. Watching her presentation from the TED Global 2010 conference has helped me fully comprehend the insignificance of this little blip we call humanity. Again, I am left to wonder why humans continue to pretend to be superior to all other life on Earth. I don't understand how we ever got this idea in our heads. Clearly we just don't look around enough anymore.
Take a moment to look around you every once in a while...
Find more inspiring and mind-blowing talks at www.TED.com
2,000 years old? Nope.
4,000 years old? Not even close.
10,000 years old? Still not close.
100,000 years old? Warmer, but no.
The oldest living thing on Earth is more than 500,000 years old. That's half a MILLION years old!!!
Artist, philosopher and biologist Rachel Sussman has spent the last five years traveling the globe in search of the world's oldest living things. She sees this project as an opportunity for humans to reconsider our idea of time. Watching her presentation from the TED Global 2010 conference has helped me fully comprehend the insignificance of this little blip we call humanity. Again, I am left to wonder why humans continue to pretend to be superior to all other life on Earth. I don't understand how we ever got this idea in our heads. Clearly we just don't look around enough anymore.
Take a moment to look around you every once in a while...
Find more inspiring and mind-blowing talks at www.TED.com
Random Thought of the Day
Have you ever heard a male lyrebird sing? No? You are missing out on LIFE!!!
David Attenborough does a nice little segment on this astounding vocalist in his series called The Life of Birds.
Not only is this footage absolutely amazing, but I also loved the subtle commentary on human impacts in the forest. Lyrebirds aren't supposed to be singing like chainsaws...
David Attenborough does a nice little segment on this astounding vocalist in his series called The Life of Birds.
Not only is this footage absolutely amazing, but I also loved the subtle commentary on human impacts in the forest. Lyrebirds aren't supposed to be singing like chainsaws...
Monday, September 20, 2010
The Power of Words
This has been on my mind for the past few weeks now and it has been drastically changing my outlook on everything that I think and do. (If you'd rather not read this entire thing, you can just skip to the end...)
Words are extremely powerful. But not in the way I know you're thinking. Not in the sense that Obama's speeches are powerful or the words of the Bible are powerful. A single word is powerful simply by existing.
Here's an extremely simple example. Does an abstract thing such as an "idea" even exist if we don't have a word for talking/thinking about it? Think about that for a second.
Now extrapolate this idea to encompass this entire internal conversation you are having with me. What if we didn't have a word for ideas? or thinking? or thinking about what someone else is thinking? We would be completely incapable of having this internal dialogue. Not only would we be unable to physically converse about this (face to face, verbally), but you would be unable to THINK about it. You would not be able to COMPREHEND this idea.
Do you understand? No?
Ok, here's another example:
In the 1970s, Nicaragua created the country's first clinic for the deaf and mute. Before this time, deaf people in Nicaragua had no standard form of communication. After the creation of this clinic, a small group of Nicaraguans INVENTED their own form of sign language. The first version of this language only had two words for thinking about other people's thoughts. Today, new children are learning this form of sign language and have invented new words. This new generation of signers has seven signs for thinking about other people's thoughts.
Researchers gave these two generations of signers a simple test to quantify their ability to think about other people's thoughts. The researchers gave each subject a comic strip showing a boy playing with a train set. The boy's little sister wants to play with the train too but her brother won't share. Then the boy packs up the train set, puts it into the toy chest and leaves the room. Once he is gone, the little sister sneaks into the room, takes the train out of the chest and hides it under the bed. When the boy gets back to the room, the researchers ask the subject (in sign, of course), "Where will the little boy look to find his train set?"
The first generation of signers (with only 2 words for thinking about other people's thoughts) all answered, "He will look under the bed, of course." The new generation of signers (with 7 words for thinking about other people's thoughts) all answered, "He will look in the toy chest because he thinks that the train is still there."
Clearly, we can understand that the little boy THINKS his train is in the chest. People without words for thinking about other people's thoughts are actually INCAPABLE of thinking about other people's thoughts.
Without a word for it, we cannot comprehend it! Wait a second. If we cannot comprehend it, does it even exist?
Listen to the whole story courtesy of Radiolab!!!
Wait, think about this for a moment: What if we didn't have language...
Would we even be capable of thought?
Scientists have researched this, of course. And no, without language -- without words -- we are incapable of thought.
In the most recent episode of Radiolab, researchers in Nicaragua discovered a perfectly intelligent man who had lived his entire life without any form of language. Imagine living 27 years without language or "thought." No, you can't. Is it really possible for us to think about what it's like not to think? RadioLab discusses it here:
Maybe it IS possible to understand what it's like not to have language. RadioLab interviewed a neurologist who had a stroke that slowly caused her to lose language. She describes her experience and what it felt like to be incapable of thought here:
Ok. If you made it through that whole post and still understand what's going on, you are pretty much amazing. If you would rather not read everything you can just listen to the whole RadioLab broadcast HERE!
It pretty much changed my life. No joke.
Words are extremely powerful. But not in the way I know you're thinking. Not in the sense that Obama's speeches are powerful or the words of the Bible are powerful. A single word is powerful simply by existing.
Here's an extremely simple example. Does an abstract thing such as an "idea" even exist if we don't have a word for talking/thinking about it? Think about that for a second.
Now extrapolate this idea to encompass this entire internal conversation you are having with me. What if we didn't have a word for ideas? or thinking? or thinking about what someone else is thinking? We would be completely incapable of having this internal dialogue. Not only would we be unable to physically converse about this (face to face, verbally), but you would be unable to THINK about it. You would not be able to COMPREHEND this idea.
Do you understand? No?
Ok, here's another example:
In the 1970s, Nicaragua created the country's first clinic for the deaf and mute. Before this time, deaf people in Nicaragua had no standard form of communication. After the creation of this clinic, a small group of Nicaraguans INVENTED their own form of sign language. The first version of this language only had two words for thinking about other people's thoughts. Today, new children are learning this form of sign language and have invented new words. This new generation of signers has seven signs for thinking about other people's thoughts.
Researchers gave these two generations of signers a simple test to quantify their ability to think about other people's thoughts. The researchers gave each subject a comic strip showing a boy playing with a train set. The boy's little sister wants to play with the train too but her brother won't share. Then the boy packs up the train set, puts it into the toy chest and leaves the room. Once he is gone, the little sister sneaks into the room, takes the train out of the chest and hides it under the bed. When the boy gets back to the room, the researchers ask the subject (in sign, of course), "Where will the little boy look to find his train set?"
The first generation of signers (with only 2 words for thinking about other people's thoughts) all answered, "He will look under the bed, of course." The new generation of signers (with 7 words for thinking about other people's thoughts) all answered, "He will look in the toy chest because he thinks that the train is still there."
Clearly, we can understand that the little boy THINKS his train is in the chest. People without words for thinking about other people's thoughts are actually INCAPABLE of thinking about other people's thoughts.
Without a word for it, we cannot comprehend it! Wait a second. If we cannot comprehend it, does it even exist?
Listen to the whole story courtesy of Radiolab!!!
Wait, think about this for a moment: What if we didn't have language...
Would we even be capable of thought?
Scientists have researched this, of course. And no, without language -- without words -- we are incapable of thought.
In the most recent episode of Radiolab, researchers in Nicaragua discovered a perfectly intelligent man who had lived his entire life without any form of language. Imagine living 27 years without language or "thought." No, you can't. Is it really possible for us to think about what it's like not to think? RadioLab discusses it here:
Maybe it IS possible to understand what it's like not to have language. RadioLab interviewed a neurologist who had a stroke that slowly caused her to lose language. She describes her experience and what it felt like to be incapable of thought here:
Ok. If you made it through that whole post and still understand what's going on, you are pretty much amazing. If you would rather not read everything you can just listen to the whole RadioLab broadcast HERE!
It pretty much changed my life. No joke.
Sunday, September 19, 2010
Look Around You
It's time to learn about...
Maths!
Note the very scientific calculator with "Stun" mode. I want one.
Maths!
Note the very scientific calculator with "Stun" mode. I want one.
Friday, September 17, 2010
Whoa! Diatom Madness!!!
Do you know what a Diatom is? Of course you do, but here's a short review just in case you forgot.
Diatoms are these cute little aquatic, single-celled, algae-like phytoplanktons. They photosynthesize, making food from sunlight and producing oxygen from carbon dioxide. Instead of constructing cell walls from cellulose or phospholipids like plants and animals, they make cell walls out of silica -- glass! This little glass house is called a frustule. Each frustules is distinct for each species of diatom, and when the diatom dies and decomposes, its silica house remains.
Check it out!
This is a dead diatom called Actinocyclus.
Here's one that is still alive!
But that's not the best part. There are some people who like diatoms so much they will PAY people to collect them and arrange them into pretty little shapes...
And some of these shapes get completely crazy
Wait, it gets better!
This last one is from the late 19th century when collectors first started commissioning and paying people for little arrangements of these single-celled plankton. This one actually has butterfly scales in it as well.
Isn't that crazy?! For Elements this year, I am planning on making an attempt at constructing my own diatom image. I'll let you know when that happens, of course!
You can take a full tour of cool diatom images here!
But I have one more before I go
Soooo COOL!
Diatoms are these cute little aquatic, single-celled, algae-like phytoplanktons. They photosynthesize, making food from sunlight and producing oxygen from carbon dioxide. Instead of constructing cell walls from cellulose or phospholipids like plants and animals, they make cell walls out of silica -- glass! This little glass house is called a frustule. Each frustules is distinct for each species of diatom, and when the diatom dies and decomposes, its silica house remains.
Check it out!
This is a dead diatom called Actinocyclus.
Here's one that is still alive!
But that's not the best part. There are some people who like diatoms so much they will PAY people to collect them and arrange them into pretty little shapes...
And some of these shapes get completely crazy
Wait, it gets better!
This last one is from the late 19th century when collectors first started commissioning and paying people for little arrangements of these single-celled plankton. This one actually has butterfly scales in it as well.
Isn't that crazy?! For Elements this year, I am planning on making an attempt at constructing my own diatom image. I'll let you know when that happens, of course!
You can take a full tour of cool diatom images here!
But I have one more before I go
Soooo COOL!
In the news this week...
The NY Times, in the Tuesday issue of the Science Times, reported on animal hybrids! Who doesn't love a cool hybridized animal or plant?
I'm sure that you've probably heard of things like ligers before, but have you ever seen a wolphin? or a Pizzly Bear? Zorse? Yeah, pretty neat, huh?
The Sea Life Park in Hawaii inadvertently created a cross between a dolphin and a false orca, calling it a wolphin. A hunter in Canada shot a huge white and brown bear with long claws and a hump on its back. Scientists later discovered that it was a polar bear-grizzly hybrid.
These kinds of animals exist all over the place and some of them aren't completely unnatural. Sometimes these hybridizations create an organism better capable of surviving in a new, changing environment. This can create completely new species! Speciation by hybridization might become a more prevalent occurrence in today's rapidly changing ecosystems, especially as habitats begin to overlap, allowing geographically isolated species to interact. This habitat overlap has caused the creation of Pizzly bears in the Arctic and Subarctic of Canada.
Keep your eyes open for more of this kind of thing in the future!
You can find the whole NY Times article here.
I'm sure that you've probably heard of things like ligers before, but have you ever seen a wolphin? or a Pizzly Bear? Zorse? Yeah, pretty neat, huh?
The Sea Life Park in Hawaii inadvertently created a cross between a dolphin and a false orca, calling it a wolphin. A hunter in Canada shot a huge white and brown bear with long claws and a hump on its back. Scientists later discovered that it was a polar bear-grizzly hybrid.
These kinds of animals exist all over the place and some of them aren't completely unnatural. Sometimes these hybridizations create an organism better capable of surviving in a new, changing environment. This can create completely new species! Speciation by hybridization might become a more prevalent occurrence in today's rapidly changing ecosystems, especially as habitats begin to overlap, allowing geographically isolated species to interact. This habitat overlap has caused the creation of Pizzly bears in the Arctic and Subarctic of Canada.
Keep your eyes open for more of this kind of thing in the future!
You can find the whole NY Times article here.
Thursday, September 16, 2010
Random Thought of the Day
Nudibranchs! The distant, much cuter cousins of snails and slugs.
Aren't they pretty?!
Wait, you don't think that's pretty? What about these?
Yeah? They're freaking ADORABLE!!! Too bad some of them (the cnidarian eating ones) incorporate whole nematocysts into their cerata. That means some of them steal the stinging parts of jellyfish and incorporate them into their own little tentacle-y things. No one knows how they do this, by the way. Think about this for a second; How on EARTH does this guy manage to grow the cells of a completely different animal in its own body? We humans have problems sharing blood with each other! These guys are literally stealing ORGANS from other animals! CRAZY!
Ok, you still don't think they're cute?
What about this one?
I knew I'd get you with that guy!
He's just so happy to see you!!!
Check out this AMAZING slideshow of nudibranch photos from National Geographic!
Aren't they pretty?!
Wait, you don't think that's pretty? What about these?
Yeah? They're freaking ADORABLE!!! Too bad some of them (the cnidarian eating ones) incorporate whole nematocysts into their cerata. That means some of them steal the stinging parts of jellyfish and incorporate them into their own little tentacle-y things. No one knows how they do this, by the way. Think about this for a second; How on EARTH does this guy manage to grow the cells of a completely different animal in its own body? We humans have problems sharing blood with each other! These guys are literally stealing ORGANS from other animals! CRAZY!
Ok, you still don't think they're cute?
What about this one?
I knew I'd get you with that guy!
He's just so happy to see you!!!
Check out this AMAZING slideshow of nudibranch photos from National Geographic!
Subscribe to:
Posts (Atom)











