New monkey discoveries are always exciting. Everyone loves finding more cute primates!
Too bad this one is butt-ugly.
The Myanmar Snub-nosed Monkey, first discovered by local hunters was finally described by science this week. A team of experts traveled to Myanmar after hearing rumors of a new species of monkey there. This is the first photographic evidence of the species.
The local hunters have killed this individual and will be eating him for dinner soon. The demand for bush meat in areas like this has driven many of rare species populations into decline.Specifically, this tiny population of monkeys (approximately 300 individuals) is also being threatened by logging and habitat fragmentation which has prompted the IUCN to label the species as Critically Endangered.
On a lighter note, because of the organism's oddly shaped nose and upturned nostrils, the Myanmar Snub-nosed Monkey apparently sneezes in the rain. Hahaha, silly monkey!
If you're interested in more information regarding this discovery, check out this link!
Potent Puzzling Ponderables Robert Ponders When He's Not Pondering Pertinently Pressing Prescribed Problems or Prose.
Thursday, October 28, 2010
Thursday, October 21, 2010
Random Thought of the Day
Ever wondered what your name is in genetic code?
Yeah! Me too!!!
Mine is
SO COOL!!!
Decode YOUR name here!
Yeah! Me too!!!
Mine is
AGANNNGACGAGAGAACCCTGGCCTGGAGA
GAGAACTGCGAGAACATCGAGAGCGAG
which just so happens to be similar to the protein called P33689|NPY_XENLA found in the genome of the African Clawed Frog (you know, those cute little aquatic pet frogs you can buy at your local drug store)!SO COOL!!!
Decode YOUR name here!
Tuesday, October 12, 2010
I have a new favorite blog!
I have been on a really big Marine Biology kick recently. As a matter of fact, I will be tested on phytoplankton, zooplankton, nekton and intertidal ecology today! Oh goodie!
Anyway, I am in love with this marine bio buff from Hawaii. Specifically, he posts some great photos of marine life with even greater captions. For example
My favorite parts are the "tags" at the bottom: OCD Shark, Reef Quiche Is Quite Tasty, EMA (for Emotional Marine Animals).
Here's another one of my favorites:
Tags: Gettin' All Nerdy Up In This Bitch, EMA
Oh my goodness. So nerdy. I love it!!!
Check out the rest of his blog, a.k.a. the Incurablog!
Anyway, I am in love with this marine bio buff from Hawaii. Specifically, he posts some great photos of marine life with even greater captions. For example
Jay thought for a second. Did he leave the oven on? He couldn’t remember if he’d turned it off after making that quiche. Dammit, now he was going to have to go back and check! This always happened before a meeting!
My favorite parts are the "tags" at the bottom: OCD Shark, Reef Quiche Is Quite Tasty, EMA (for Emotional Marine Animals).
Here's another one of my favorites:
So then he says,
“Non-Obligate Ram Ventilator? I hardly know ‘er!”
And then he makes this face.
Tags: Gettin' All Nerdy Up In This Bitch, EMA
Oh my goodness. So nerdy. I love it!!!
Check out the rest of his blog, a.k.a. the Incurablog!
Thursday, October 7, 2010
The Creatures of Avatar!
Have you seen that little movie that came out recently called Avatar?
You have? Oh good!
Did you know that there are active evolutionary biologists, xenobiologists and exobiologists dedicated to researching the flora and fauna of Pandora and the other moons of Polyphemus?
Yes, you are correct, Pandora and Polyphemus are not real places. And yes, it is true that most of these plants and animals do not exist... most of them...
Believe it or not, not all of these crazy creatures and fantastic plants are fake. I don't want to give away all the good stuff since Elements Science Magazine will be publishing a major feature article on the science behind these (mostly) fictional creatures, so here's my favorite:
The Great Leonopteryx. Or in the language of the Na'vi, Toruk
Actually, toruk is based on an ancient creature that once ruled the skies of our very planet. This flying dinosaur, called Tapejara, was a piscivorous giant with a 16-foot wingspan and a crest between 4 and 6 feet long!
Can you see the resemblance?
For more info on the flora and fauna of Pandora, check out this great Interactive Field Guide!
You have? Oh good!
Did you know that there are active evolutionary biologists, xenobiologists and exobiologists dedicated to researching the flora and fauna of Pandora and the other moons of Polyphemus?
Yes, you are correct, Pandora and Polyphemus are not real places. And yes, it is true that most of these plants and animals do not exist... most of them...
Believe it or not, not all of these crazy creatures and fantastic plants are fake. I don't want to give away all the good stuff since Elements Science Magazine will be publishing a major feature article on the science behind these (mostly) fictional creatures, so here's my favorite:
The Great Leonopteryx. Or in the language of the Na'vi, Toruk
Actually, toruk is based on an ancient creature that once ruled the skies of our very planet. This flying dinosaur, called Tapejara, was a piscivorous giant with a 16-foot wingspan and a crest between 4 and 6 feet long!
Can you see the resemblance?
For more info on the flora and fauna of Pandora, check out this great Interactive Field Guide!
Random Thought of the Day
Craig Venter recently announced that his team of scientists have created the very first synthetic lifeforms. Using a computer code and a few jars of chemicals, Venter and his researchers have created a brand new species of bacteria.
He says that with this breakthrough, we have gained an intimate understanding of the complexities of life which will soon allow us to invent life as we desire.
"We have a program with Exxon Mobile to try and develop new strains of algae [seaweed] that can efficiently capture carbon dioxide from the atmosphere or from concentrated sources [such as the recent oil spill in the Gulf], to make new hydrocarbons that can go into their refineries to make normal gasoline and diesel fuel out of CO2." -Craig Venter, May 2010
See the whole presentation here: Craig Venter unveils "synthetic life"
He says that with this breakthrough, we have gained an intimate understanding of the complexities of life which will soon allow us to invent life as we desire.
"We have a program with Exxon Mobile to try and develop new strains of algae [seaweed] that can efficiently capture carbon dioxide from the atmosphere or from concentrated sources [such as the recent oil spill in the Gulf], to make new hydrocarbons that can go into their refineries to make normal gasoline and diesel fuel out of CO2." -Craig Venter, May 2010
See the whole presentation here: Craig Venter unveils "synthetic life"
Wednesday, October 6, 2010
Have you ever GoogleMaps-ed Antarctica?
Not only has GoogleMaps documented Antarctica for your directional convenience, but they have also included...
STREET VIEW!!!
Note that the "street view figure" has been changed to a cute little penguin!!!
Now go forth and explore the antarctic!
STREET VIEW!!!
Note that the "street view figure" has been changed to a cute little penguin!!!
Now go forth and explore the antarctic!
Tuesday, October 5, 2010
I am having problems escaping these little guys...
Nudibranchs. Again.
But, c'mon! THEY ARE SO FREAKING COOL!!!!
For example: this is not a creature from a Kingdom Hearts/Final Fantasy video game. This is real nudibranch!!!
Oh. my. goodness.
Here's another:
And another for good measure:
But, c'mon! THEY ARE SO FREAKING COOL!!!!
For example: this is not a creature from a Kingdom Hearts/Final Fantasy video game. This is real nudibranch!!!
Oh. my. goodness.
Here's another:
And another for good measure:
It's so tiny!!! Like a tiny glob of toothpaste!!!
Ok, I couldn't resist. Here's one more:
Bahaha! I freaking LOVE NUDIBRANCHS!!!!!
In case you couldn't tell...
Also, I found all of these great photos via fuckyeahbranchs.tumblr.com
Check. it. out.
Random Thought of the Day
So there's this friend of mine who is really in to mucus.
No, not music, mucus.
You may think mucus is a weird thing to be bonkers about, but you just haven't seen the wonders of MAGIC MUCUS!
For example, the lungfish (a type of fish with a lung) can do this nifty little trick when all the water in its pond dries up; they burrow down into the mud and secrete a sac of (you guessed it!) mucus! This mucus sac solidifies, trapping moisture around their bodies. They can stay in this state of suspended animation for up to four years!!! That's some pretty cool mucus!
Ok, Here's another. Parrot fish secret a mucus bubble when they go to sleep each night. These are pretty big fish. Some can be up to a meter long (that's more than 3 feet, for all you non-metric users). So that's a lot of mucus! This isn't your average mucus bubble either. It holds the fish in place while it sleeps, it hides its scent from predators, serves as an intruder alarm system, has antioxidant properties that may heal damaged tissues, and protects against UV rays. I'd like to see YOUR mucus do that!
Ok, one more. You may already know this, but nudibranchs also have really cool mucus. Specifically, the Shaggy Mouse nudi (Aeolidia papillosa) uses its mucus to defend against the stinging tentacles of its favorite food: anemones!!! It secretes a layer of mucus over the tentacles of the anemone which relaxes the anemone's nematocyts (stinging cells) preventing them from firing their stinging barbs. The coolest part about these nudis is that they secrete a specific mucus for each type of anemone they eat!!! That's some really smart mucus!
No, not music, mucus.
You may think mucus is a weird thing to be bonkers about, but you just haven't seen the wonders of MAGIC MUCUS!
For example, the lungfish (a type of fish with a lung) can do this nifty little trick when all the water in its pond dries up; they burrow down into the mud and secrete a sac of (you guessed it!) mucus! This mucus sac solidifies, trapping moisture around their bodies. They can stay in this state of suspended animation for up to four years!!! That's some pretty cool mucus!
Ok, Here's another. Parrot fish secret a mucus bubble when they go to sleep each night. These are pretty big fish. Some can be up to a meter long (that's more than 3 feet, for all you non-metric users). So that's a lot of mucus! This isn't your average mucus bubble either. It holds the fish in place while it sleeps, it hides its scent from predators, serves as an intruder alarm system, has antioxidant properties that may heal damaged tissues, and protects against UV rays. I'd like to see YOUR mucus do that!
Ok, one more. You may already know this, but nudibranchs also have really cool mucus. Specifically, the Shaggy Mouse nudi (Aeolidia papillosa) uses its mucus to defend against the stinging tentacles of its favorite food: anemones!!! It secretes a layer of mucus over the tentacles of the anemone which relaxes the anemone's nematocyts (stinging cells) preventing them from firing their stinging barbs. The coolest part about these nudis is that they secrete a specific mucus for each type of anemone they eat!!! That's some really smart mucus!
Subscribe to:
Posts (Atom)
